| mature miRNA ID | hsa-mir-101-3p |
| mature miRNA accession | MIMAT0000099 |
| mature miRNA seq | UACAGUACUGUGAUAACUGAA |
| primary miRNA ID | accession | cooridnate(hg38) | strand | sequence |
|---|---|---|---|---|
| hsa-mir-101-1 | MI0000103 | chr1:65058434-65058508 | - | UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCUAUUCUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCA |
| hsa-mir-101-2 | MI0000739 | chr9:4850297-4850375 | + | ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUGAUAACUGAAGAAUGGUGGU |
Many studies have demonstrated that bioactive small molecules (or drugs) can regulate the miRNA expression, which indicate that targeting miRNAs with small molecules is a new type of therapy for human diseases. SM2miR is a manual curated database which collects and incorporates the experimentally validated small molecules' effects on miRNA expression in 21 species from the published papers. Each entry contains the detailed information about small molecules, miRNAs and their relationships, including species, small molecule name, DrugBank Accession number, PubChem CID, approved by FDA or not, miRNA name, miRBase Accession number, expression pattern of miRNA, experimental detection method, tissues or conditions for detection, evidences in the reference, PubMed ID and the published year of the reference.
MicroRNAs (miRNAs) are short regulatory RNAs that down-regulate gene expression. They are essential for cell homeostasis and active in many disease states. A major discovery is the ability of miRNAs to determine the efficacy of drugs, which has given rise to the field of 'miRNA pharmacogenomics' through 'Pharmaco-miRs'. miRNAs play a significant role in pharmacogenomics by down-regulating genes that are important for drug function. These interactions can be described as triplet sets consisting of a miRNA, a target gene and a drug associated with the gene
miRNA targeting information derive from both experimental data and computational predictions, and protein-drug interactions are annotated by the Pharmacogenomics Knowledge base (PharmGKB).